mutation t@sting |
documentation |
Prediction |
disease causing |
Model: without_aae, prob: 1 (explain) | |||||||||||||||
Summary |
|
hyperlink | |||||||||||||||
analysed issue | analysis result | ||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
name of alteration | no title | ||||||||||||||||
alteration (phys. location) | chr17:4802804G>AN/A show variant in all transcripts IGV | ||||||||||||||||
HGNC symbol | C17orf107 | ||||||||||||||||
Ensembl transcript ID | ENST00000521575 | ||||||||||||||||
Genbank transcript ID | N/A | ||||||||||||||||
UniProt peptide | Q6ZR85 | ||||||||||||||||
alteration type | single base exchange | ||||||||||||||||
alteration region | 5'UTR | ||||||||||||||||
DNA changes | cDNA.92G>A g.92G>A | ||||||||||||||||
AA changes | N/A | ||||||||||||||||
position(s) of altered AA if AA alteration in CDS | N/A | ||||||||||||||||
frameshift | N/A | ||||||||||||||||
known variant | Reference ID: rs121909515
Allele 'A' was neither found in ExAC nor 1000G. known as potential disease variant: rs18358 (probable pathogenic for Congenital myasthenic syndrome 4C|not provided) dbSNP NCBI variation viewer known disease mutation at this position, please check HGMD for details (HGMD ID CM970309) known disease mutation at this position, please check HGMD for details (HGMD ID CM970309) known disease mutation at this position, please check HGMD for details (HGMD ID CM970309) | ||||||||||||||||
regulatory features | Promoter Associated, Regulatory Feature, Promoter like regulatory feature H3K4me2, Histone, Histone 3 Lysine 4 Di-Methylation H2BK120ac, Histone, Histone 2B Lysine 120 Acetylation H3K27me3, Histone, Histone 3 Lysine 27 Tri-Methylation PolII, Polymerase, RNA Polymerase II H3K36me3, Histone, Histone 3 Lysine 36 Tri-Methylation H3K36ac, Histone, Histone 3 Lysine 36 Acetylation H2AZ, Histone, Histone 2A variant Z Gene Associated, Regulatory Feature, Gene associated regulatory feature H4K91ac, Histone, Histone 4 Lysine 91 Acetylation H3K18ac, Histone, Histone 3 Lysine 18 Acetylation H2BK20ac, Histone, Histone 2B Lysine 20 Acetylation H3K27ac, Histone, Histone 3 Lysine 27 Acetylation H3K4me3, Histone, Histone 3 Lysine 4 Tri-Methylation H3K4ac, Histone, Histone 3 Lysine 4 Acetylation DNase1, Open Chromatin, DNase1 Hypersensitive Site | ||||||||||||||||
phyloP / phastCons |
| ||||||||||||||||
splice sites | splice site change before start ATG (at aa -83) |
| ||||||||||||||||
distance from splice site | 92 | ||||||||||||||||
Kozak consensus sequence altered? | no | ||||||||||||||||
conservation protein level for non-synonymous changes | N/A | ||||||||||||||||
protein features | no protein features affected | ||||||||||||||||
length of protein | N/A | ||||||||||||||||
AA sequence altered | N/A | ||||||||||||||||
position of stopcodon in wt / mu CDS | N/A | ||||||||||||||||
position (AA) of stopcodon in wt / mu AA sequence | N/A | ||||||||||||||||
position of stopcodon in wt / mu cDNA | N/A | ||||||||||||||||
poly(A) signal | N/A | ||||||||||||||||
conservation nucleotide level for all changes - no scoring up to now | N/A | ||||||||||||||||
position of start ATG in wt / mu cDNA | 346 / 346 | ||||||||||||||||
chromosome | 17 | ||||||||||||||||
strand | 1 | ||||||||||||||||
last intron/exon boundary | 412 | ||||||||||||||||
theoretical NMD boundary in CDS | 16 | ||||||||||||||||
length of CDS | 297 | ||||||||||||||||
coding sequence (CDS) position | N/A | ||||||||||||||||
cDNA position (for ins/del: last normal base / first normal base) | 92 | ||||||||||||||||
gDNA position (for ins/del: last normal base / first normal base) | 92 | ||||||||||||||||
chromosomal position (for ins/del: last normal base / first normal base) | 4802804 | ||||||||||||||||
original gDNA sequence snippet | GGCGTGGGTGGTGGGCGTCCGCTGGGACACGTTGAGCACGA | ||||||||||||||||
altered gDNA sequence snippet | GGCGTGGGTGGTGGGCGTCCACTGGGACACGTTGAGCACGA | ||||||||||||||||
original cDNA sequence snippet | GGCGTGGGTGGTGGGCGTCCGCTGGGACACGTTGAGCACGA | ||||||||||||||||
altered cDNA sequence snippet | GGCGTGGGTGGTGGGCGTCCACTGGGACACGTTGAGCACGA | ||||||||||||||||
wildtype AA sequence | MKGTPSSLDT LMWIYHFHSS TEVALQPPLL SSLELSVAAA HEYLEQRFRE LKSLEPPEPK MQGMLPAPKP TLGLVLREAT ASLVSFGTTL LEVGYWGA* | ||||||||||||||||
mutated AA sequence | N/A | ||||||||||||||||
speed | 0.99 s | ||||||||||||||||