mutation t@sting |
documentation |
Prediction |
polymorphism |
Model: without_aae, prob: 1.25470307920951e-16 (classification due to TGP/ExAC, real probability is shown anyway) (explain) | |||||||||||||||||||||||||||||||||||||||||||||
Summary |
|
hyperlink | |||||||||||||||||||||||||||||||||||||||||||||
analysed issue | analysis result | ||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
name of alteration | no title | ||||||||||||||||||||||||||||||||||||||||||||||
alteration (phys. location) | chr19:41255500C>GN/A show variant in all transcripts IGV | ||||||||||||||||||||||||||||||||||||||||||||||
HGNC symbol | C19orf54 | ||||||||||||||||||||||||||||||||||||||||||||||
Ensembl transcript ID | ENST00000339153 | ||||||||||||||||||||||||||||||||||||||||||||||
Genbank transcript ID | N/A | ||||||||||||||||||||||||||||||||||||||||||||||
UniProt peptide | Q5BKX5 | ||||||||||||||||||||||||||||||||||||||||||||||
alteration type | single base exchange | ||||||||||||||||||||||||||||||||||||||||||||||
alteration region | 5'UTR | ||||||||||||||||||||||||||||||||||||||||||||||
DNA changes | cDNA.232G>C g.909G>C | ||||||||||||||||||||||||||||||||||||||||||||||
AA changes | N/A | ||||||||||||||||||||||||||||||||||||||||||||||
position(s) of altered AA if AA alteration in CDS | N/A | ||||||||||||||||||||||||||||||||||||||||||||||
frameshift | N/A | ||||||||||||||||||||||||||||||||||||||||||||||
known variant | Reference ID: rs2254343
| ||||||||||||||||||||||||||||||||||||||||||||||
regulatory features | DNase1, Open Chromatin, DNase1 Hypersensitive Site H3K27ac, Histone, Histone 3 Lysine 27 Acetylation H3K4me2, Histone, Histone 3 Lysine 4 Di-Methylation H3K4me3, Histone, Histone 3 Lysine 4 Tri-Methylation H3K79me2, Histone, Histone 3 Lysine 79 di-methylation H3K9ac, Histone, Histone 3 Lysine 9 Acetylation H4K91ac, Histone, Histone 4 Lysine 91 Acetylation PolII, Polymerase, RNA Polymerase II Promoter Associated, Regulatory Feature, Promoter like regulatory feature ZBTB7A, Transcription Factor, ZBTB7A Transcription Factor Binding | ||||||||||||||||||||||||||||||||||||||||||||||
phyloP / phastCons |
| ||||||||||||||||||||||||||||||||||||||||||||||
splice sites | splice site change before start ATG (at aa -59) | splice site change before start ATG (at aa -58) | splice site change before start ATG (at aa -57) |
| ||||||||||||||||||||||||||||||||||||||||||||||
distance from splice site | 13 | ||||||||||||||||||||||||||||||||||||||||||||||
Kozak consensus sequence altered? | no | ||||||||||||||||||||||||||||||||||||||||||||||
conservation protein level for non-synonymous changes | N/A | ||||||||||||||||||||||||||||||||||||||||||||||
protein features |
| ||||||||||||||||||||||||||||||||||||||||||||||
length of protein | N/A | ||||||||||||||||||||||||||||||||||||||||||||||
AA sequence altered | N/A | ||||||||||||||||||||||||||||||||||||||||||||||
position of stopcodon in wt / mu CDS | N/A | ||||||||||||||||||||||||||||||||||||||||||||||
position (AA) of stopcodon in wt / mu AA sequence | N/A | ||||||||||||||||||||||||||||||||||||||||||||||
position of stopcodon in wt / mu cDNA | N/A | ||||||||||||||||||||||||||||||||||||||||||||||
poly(A) signal | N/A | ||||||||||||||||||||||||||||||||||||||||||||||
conservation nucleotide level for all changes - no scoring up to now | N/A | ||||||||||||||||||||||||||||||||||||||||||||||
position of start ATG in wt / mu cDNA | 416 / 416 | ||||||||||||||||||||||||||||||||||||||||||||||
chromosome | 19 | ||||||||||||||||||||||||||||||||||||||||||||||
strand | -1 | ||||||||||||||||||||||||||||||||||||||||||||||
last intron/exon boundary | 812 | ||||||||||||||||||||||||||||||||||||||||||||||
theoretical NMD boundary in CDS | 346 | ||||||||||||||||||||||||||||||||||||||||||||||
length of CDS | 420 | ||||||||||||||||||||||||||||||||||||||||||||||
coding sequence (CDS) position | N/A | ||||||||||||||||||||||||||||||||||||||||||||||
cDNA position (for ins/del: last normal base / first normal base) | 232 | ||||||||||||||||||||||||||||||||||||||||||||||
gDNA position (for ins/del: last normal base / first normal base) | 909 | ||||||||||||||||||||||||||||||||||||||||||||||
chromosomal position (for ins/del: last normal base / first normal base) | 41255500 | ||||||||||||||||||||||||||||||||||||||||||||||
original gDNA sequence snippet | TGCCACAGGGCCTGCTCCCCGTCATGTCTTCGGCCTGGAGA | ||||||||||||||||||||||||||||||||||||||||||||||
altered gDNA sequence snippet | TGCCACAGGGCCTGCTCCCCCTCATGTCTTCGGCCTGGAGA | ||||||||||||||||||||||||||||||||||||||||||||||
original cDNA sequence snippet | ACTCAAAGGGCCTGCTCCCCGTCATGTCTTCGGCCTGGAGA | ||||||||||||||||||||||||||||||||||||||||||||||
altered cDNA sequence snippet | ACTCAAAGGGCCTGCTCCCCCTCATGTCTTCGGCCTGGAGA | ||||||||||||||||||||||||||||||||||||||||||||||
wildtype AA sequence | MRAGGLVDGR YSPVAPQWRP PGETHTGGHG KRLHGPGRDV LSTSYDEDFN HEPCQRKGHK AHWAVSAGVL LGVRAVPSLG YTEDPELPGL FHPVLGTPCQ PPSLPEEGSP GAVYLLSKQG KSWHYQLWDY DQGPPLSSH* | ||||||||||||||||||||||||||||||||||||||||||||||
mutated AA sequence | N/A | ||||||||||||||||||||||||||||||||||||||||||||||
speed | 0.88 s | ||||||||||||||||||||||||||||||||||||||||||||||