Prediction |
polymorphism |
Model: without_aae, prob: 9.12231374998112e-11 (classification due to TGP/ExAC,
real probability is shown anyway)
(explain) |
Summary |
- homozygous in TGP or ExAC
- known disease mutation at this position (HGMD CM083726)
- protein features (might be) affected
- splice site changes
|
hyperlink |
analysed issue |
analysis result |
name of alteration | no title |
alteration (phys. location) | chr1:45797505C>GN/A
show variant in all transcripts IGV
|
HGNC symbol | MUTYH |
Ensembl transcript ID | ENST00000531105 |
Genbank transcript ID | N/A |
UniProt peptide | Q9UIF7 |
alteration type | single base exchange |
alteration region | intron |
DNA changes | g.8638G>C |
AA changes | N/A |
position(s) of altered AA if AA alteration in CDS | N/A |
frameshift | N/A |
known variant | Reference ID: rs3219489
database | homozygous (G/G) | heterozygous | allele carriers |
1000G | 280 | 1010 | 1290 |
ExAC | 4266 | 20333 | 24599 |
known disease mutation at this position, please check HGMD for details (HGMD ID CM083726)
|
regulatory features | H3K36me3, Histone, Histone 3 Lysine 36 Tri-Methylation |
phyloP / phastCons | | PhyloP | PhastCons |
(flanking) | 4.756 | 0.999 | | -0.078 | 0.335 | (flanking) | 0.088 | 0.335 | explain score(s) and/or inspect your position(s) in in UCSC Genome Browser |
splice sites | effect | gDNA position | score | wt detection sequence | exon-intron border | Acc increased | 8633 | wt: 0.63 / mu: 0.72 | wt: CGTTCCCAGCTCCCAACACTGGACAGTGCCACCTGTGCCTG mu: CGTTCCCAGCTCCCAACACTGGACACTGCCACCTGTGCCTG | actg|GACA | Donor marginally increased | 8639 | wt: 0.4745 / mu: 0.5174 (marginal change - not scored) | wt: GACAGTGCCACCTGT mu: GACACTGCCACCTGT | CAGT|gcca | Donor marginally increased | 8630 | wt: 0.2529 / mu: 0.3326 (marginal change - not scored) | wt: CCAACACTGGACAGT mu: CCAACACTGGACACT | AACA|ctgg | Acc gained | 8646 | 0.48 | mu: CAACACTGGACACTGCCACCTGTGCCTGCCTCCCTCGGAGC | acct|GTGC |
|
distance from splice site | 2396 |
Kozak consensus sequence altered? | N/A |
conservation protein level for non-synonymous changes | N/A |
protein features | start (aa) | end (aa) | feature | details | | 87 | 104 | HELIX | | might get lost (downstream of altered splice site) | 109 | 116 | HELIX | | might get lost (downstream of altered splice site) | 120 | 135 | HELIX | | might get lost (downstream of altered splice site) | 139 | 152 | HELIX | | might get lost (downstream of altered splice site) | 156 | 160 | HELIX | | might get lost (downstream of altered splice site) | 164 | 171 | HELIX | | might get lost (downstream of altered splice site) | 177 | 193 | HELIX | | might get lost (downstream of altered splice site) | 202 | 208 | HELIX | | might get lost (downstream of altered splice site) | 214 | 224 | HELIX | | might get lost (downstream of altered splice site) | 234 | 243 | HELIX | | might get lost (downstream of altered splice site) | 253 | 266 | HELIX | | might get lost (downstream of altered splice site) | 272 | 285 | HELIX | | might get lost (downstream of altered splice site) | 287 | 287 | METAL | Iron-sulfur (4Fe-4S) (By similarity). | might get lost (downstream of altered splice site) | 289 | 291 | STRAND | | might get lost (downstream of altered splice site) | 294 | 294 | METAL | Iron-sulfur (4Fe-4S) (By similarity). | might get lost (downstream of altered splice site) | 297 | 297 | METAL | Iron-sulfur (4Fe-4S) (By similarity). | might get lost (downstream of altered splice site) | 300 | 302 | HELIX | | might get lost (downstream of altered splice site) | 303 | 303 | METAL | Iron-sulfur (4Fe-4S) (By similarity). | might get lost (downstream of altered splice site) | 304 | 316 | HELIX | | might get lost (downstream of altered splice site) | 330 | 332 | HELIX | | might get lost (downstream of altered splice site) | 358 | 360 | STRAND | | might get lost (downstream of altered splice site) | 364 | 495 | DOMAIN | Nudix hydrolase. | might get lost (downstream of altered splice site) | 366 | 377 | STRAND | | might get lost (downstream of altered splice site) | 379 | 388 | STRAND | | might get lost (downstream of altered splice site) | 403 | 405 | STRAND | | might get lost (downstream of altered splice site) | 410 | 424 | HELIX | | might get lost (downstream of altered splice site) | 447 | 456 | STRAND | | might get lost (downstream of altered splice site) | 470 | 474 | STRAND | | might get lost (downstream of altered splice site) | 475 | 480 | HELIX | | might get lost (downstream of altered splice site) | 485 | 495 | HELIX | | might get lost (downstream of altered splice site) |
|
length of protein | N/A |
AA sequence altered | N/A |
position of stopcodon in wt / mu CDS | N/A |
position (AA) of stopcodon in wt / mu AA sequence | N/A |
position of stopcodon in wt / mu cDNA | N/A |
poly(A) signal | N/A |
conservation nucleotide level for all changes - no scoring up to now | N/A |
position of start ATG in wt / mu cDNA | 195 / 195 |
chromosome | 1 |
strand | -1 |
last intron/exon boundary | 310 |
theoretical NMD boundary in CDS | 65 |
length of CDS | 189 |
coding sequence (CDS) position | N/A |
cDNA position (for ins/del: last normal base / first normal base) | N/A |
gDNA position (for ins/del: last normal base / first normal base) | 8638 |
chromosomal position (for ins/del: last normal base / first normal base) | 45797505 |
original gDNA sequence snippet | CCAGCTCCCAACACTGGACAGTGCCACCTGTGCCTGCCTCC |
altered gDNA sequence snippet | CCAGCTCCCAACACTGGACACTGCCACCTGTGCCTGCCTCC |
original cDNA sequence snippet | N/A |
altered cDNA sequence snippet | N/A |
wildtype AA sequence | MRKPRAAVGS GHRKQAASQE GRQKHAKNNS QAKPSACDGF QKVPGVLSVQ SEKAPHGPAS PG* |
mutated AA sequence | N/A |
speed | 1.03 s |
|
|