Prediction |
polymorphism |
Model: without_aae, prob: 0.999996898682688
(explain) |
Summary |
- protein features (might be) affected
- splice site changes
|
hyperlink |
analysed issue |
analysis result |
name of alteration | no title |
alteration (phys. location) | chr3:75787372A>TN/A
show variant in all transcripts IGV
|
HGNC symbol | ZNF717 |
Ensembl transcript ID | ENST00000477374 |
Genbank transcript ID | N/A |
UniProt peptide | Q9BY31 |
alteration type | single base exchange |
alteration region | intron |
DNA changes | g.47363T>A |
AA changes | N/A |
position(s) of altered AA if AA alteration in CDS | N/A |
frameshift | N/A |
known variant | Reference ID: rs62250108
Allele 'T' was neither found in ExAC nor 1000G. |
regulatory features | Gene Associated, Regulatory Feature, Gene associated regulatory feature H3K36me3, Histone, Histone 3 Lysine 36 Tri-Methylation H3K9me3, Histone, Histone 3 Lysine 9 Tri-Methylation H4K20me3, Histone, Histone 4 Lysine 20 Tri-Methylation ZNF274, Transcription Factor, ZNF274 Transcription Factor Binding |
phyloP / phastCons | | PhyloP | PhastCons |
(flanking) | -1.689 | 0 | | -2.691 | 0 | (flanking) | -2.484 | 0 | explain score(s) and/or inspect your position(s) in in UCSC Genome Browser |
splice sites | effect | gDNA position | score | wt detection sequence | exon-intron border | Donor increased | 47360 | wt: 0.34 / mu: 0.39 | wt: ACCTCAGGTTACATC mu: ACCTCAGGATACATC | CTCA|ggtt | Donor increased | 47367 | wt: 0.75 / mu: 0.86 | wt: GTTACATCAGAGAAC mu: GATACATCAGAGAAC | TACA|tcag |
|
distance from splice site | 3055 |
Kozak consensus sequence altered? | N/A |
conservation protein level for non-synonymous changes | N/A |
protein features | start (aa) | end (aa) | feature | details | | 202 | 224 | ZN_FING | C2H2-type 1; degenerate. | might get lost (downstream of altered splice site) | 259 | 270 | ZN_FING | C2H2-type 2; degenerate. | might get lost (downstream of altered splice site) | 276 | 298 | ZN_FING | C2H2-type 3; degenerate. | might get lost (downstream of altered splice site) | 304 | 326 | ZN_FING | C2H2-type 4. | might get lost (downstream of altered splice site) | 332 | 354 | ZN_FING | C2H2-type 5. | might get lost (downstream of altered splice site) | 360 | 382 | ZN_FING | C2H2-type 6. | might get lost (downstream of altered splice site) | 388 | 410 | ZN_FING | C2H2-type 7. | might get lost (downstream of altered splice site) | 391 | 391 | MOD_RES | Phosphoserine. | might get lost (downstream of altered splice site) | 396 | 396 | MOD_RES | Phosphothreonine. | might get lost (downstream of altered splice site) | 398 | 398 | MOD_RES | Phosphoserine. | might get lost (downstream of altered splice site) | 402 | 402 | MOD_RES | Phosphotyrosine. | might get lost (downstream of altered splice site) | 416 | 438 | ZN_FING | C2H2-type 8. | might get lost (downstream of altered splice site) | 444 | 466 | ZN_FING | C2H2-type 9. | might get lost (downstream of altered splice site) | 472 | 494 | ZN_FING | C2H2-type 10. | might get lost (downstream of altered splice site) | 500 | 522 | ZN_FING | C2H2-type 11. | might get lost (downstream of altered splice site) | 528 | 550 | ZN_FING | C2H2-type 12. | might get lost (downstream of altered splice site) | 556 | 578 | ZN_FING | C2H2-type 13. | might get lost (downstream of altered splice site) | 584 | 606 | ZN_FING | C2H2-type 14. | might get lost (downstream of altered splice site) | 612 | 634 | ZN_FING | C2H2-type 15. | might get lost (downstream of altered splice site) | 642 | 659 | ZN_FING | C2H2-type 16; degenerate. | might get lost (downstream of altered splice site) | 664 | 664 | CONFLICT | R -> H (in Ref. 2; AAK28319). | might get lost (downstream of altered splice site) | 731 | 742 | ZN_FING | C2H2-type 17; degenerate. | might get lost (downstream of altered splice site) | 748 | 770 | ZN_FING | C2H2-type 18. | might get lost (downstream of altered splice site) | 776 | 798 | ZN_FING | C2H2-type 19. | might get lost (downstream of altered splice site) | 804 | 826 | ZN_FING | C2H2-type 20. | might get lost (downstream of altered splice site) | 832 | 854 | ZN_FING | C2H2-type 21. | might get lost (downstream of altered splice site) | 860 | 882 | ZN_FING | C2H2-type 22. | might get lost (downstream of altered splice site) |
|
length of protein | N/A |
AA sequence altered | N/A |
position of stopcodon in wt / mu CDS | N/A |
position (AA) of stopcodon in wt / mu AA sequence | N/A |
position of stopcodon in wt / mu cDNA | N/A |
poly(A) signal | N/A |
conservation nucleotide level for all changes - no scoring up to now | N/A |
position of start ATG in wt / mu cDNA | 173 / 173 |
chromosome | 3 |
strand | -1 |
last intron/exon boundary | 512 |
theoretical NMD boundary in CDS | 289 |
length of CDS | 345 |
coding sequence (CDS) position | N/A |
cDNA position (for ins/del: last normal base / first normal base) | N/A |
gDNA position (for ins/del: last normal base / first normal base) | 47363 |
chromosomal position (for ins/del: last normal base / first normal base) | 75787372 |
original gDNA sequence snippet | TCAATAAGTCAAACCTCAGGTTACATCAGAGAACTCACACA |
altered gDNA sequence snippet | TCAATAAGTCAAACCTCAGGATACATCAGAGAACTCACACA |
original cDNA sequence snippet | N/A |
altered cDNA sequence snippet | N/A |
wildtype AA sequence | MFPVFSGCFQ ELQEKNKSLE LVSFEEVAVH FTWEEWQDLD DAQRTLYRDV MLETYSSLVS LGHYITKPEM IFKLEQGAEP WIVEETPNLR LSGGSKKQVF SGICHRSLVE LQEV* |
mutated AA sequence | N/A |
speed | 0.89 s |
|
|