|
|
mutation t@sting |
documentation |
Prediction |
polymorphism |
Model: without_aae, prob: 1.91424205473924e-27 (classification due to TGP/ExAC, real probability is shown anyway) (explain) | ||||||||||||
| Summary |
|
hyperlink | ||||||||||||
| analysed issue | analysis result | |||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| name of alteration | no title | |||||||||||||
| alteration (phys. location) | chr17:46629593G>TN/A show variant in all transcripts IGV | |||||||||||||
| HGNC symbol | HOXB-AS3 | |||||||||||||
| Ensembl transcript ID | ENST00000465846 | |||||||||||||
| Genbank transcript ID | N/A | |||||||||||||
| UniProt peptide | N/A | |||||||||||||
| alteration type | single base exchange | |||||||||||||
| alteration region | intron | |||||||||||||
| DNA changes | g.2602G>T | |||||||||||||
| AA changes | N/A | |||||||||||||
| position(s) of altered AA if AA alteration in CDS | N/A | |||||||||||||
| frameshift | N/A | |||||||||||||
| known variant | Reference ID: rs2229304
| |||||||||||||
| regulatory features | DNase1, Open Chromatin, DNase1 Hypersensitive Site Gene Associated, Regulatory Feature, Gene associated regulatory feature H3K27ac, Histone, Histone 3 Lysine 27 Acetylation H3K27me3, Histone, Histone 3 Lysine 27 Tri-Methylation H3K36me3, Histone, Histone 3 Lysine 36 Tri-Methylation H3K4ac, Histone, Histone 3 Lysine 4 Acetylation H3K4me2, Histone, Histone 3 Lysine 4 Di-Methylation H3K79me2, Histone, Histone 3 Lysine 79 di-methylation H3K9ac, Histone, Histone 3 Lysine 9 Acetylation | |||||||||||||
| phyloP / phastCons |
| |||||||||||||
| splice sites | no abrogation of potential splice sites | |||||||||||||
| distance from splice site | 2285 | |||||||||||||
| Kozak consensus sequence altered? | N/A | |||||||||||||
| conservation protein level for non-synonymous changes | N/A | |||||||||||||
| protein features | N/A | |||||||||||||
| length of protein | N/A | |||||||||||||
| AA sequence altered | N/A | |||||||||||||
| position of stopcodon in wt / mu CDS | N/A | |||||||||||||
| position (AA) of stopcodon in wt / mu AA sequence | N/A | |||||||||||||
| position of stopcodon in wt / mu cDNA | N/A | |||||||||||||
| poly(A) signal | N/A | |||||||||||||
| conservation nucleotide level for all changes - no scoring up to now | N/A | |||||||||||||
| position of start ATG in wt / mu cDNA | 134 / 134 | |||||||||||||
| chromosome | 17 | |||||||||||||
| strand | 1 | |||||||||||||
| last intron/exon boundary | 177 | |||||||||||||
| theoretical NMD boundary in CDS | cannot be calculated, too little distance between start ATG and last intron/exon boundary | |||||||||||||
| length of CDS | 231 | |||||||||||||
| coding sequence (CDS) position | N/A | |||||||||||||
| cDNA position (for ins/del: last normal base / first normal base) | N/A | |||||||||||||
| gDNA position (for ins/del: last normal base / first normal base) | 2602 | |||||||||||||
| chromosomal position (for ins/del: last normal base / first normal base) | 46629593 | |||||||||||||
| original gDNA sequence snippet | GCCAGGCGGGGCCGACAGGGGCTCGGGGGCCAGACCCGGCC | |||||||||||||
| altered gDNA sequence snippet | GCCAGGCGGGGCCGACAGGGTCTCGGGGGCCAGACCCGGCC | |||||||||||||
| original cDNA sequence snippet | N/A | |||||||||||||
| altered cDNA sequence snippet | N/A | |||||||||||||
| wildtype AA sequence | MKENSASSLL SKPRGRLRLK RSRMEEGIGT HLQTSTVSRK FGSIPSPRTH QPRSWQNPLT NQENTDPVCL LTTEWN* | |||||||||||||
| mutated AA sequence | N/A | |||||||||||||
| speed | 1.07 s | |||||||||||||