mutation t@sting |
documentation |
Prediction |
polymorphism |
Model: without_aae, prob: 0.999995190883267 (classification due to TGP/ExAC, real probability is shown anyway) (explain) | |||||||||||||||||||||||||||||||||||||||||||||
Summary |
|
hyperlink | |||||||||||||||||||||||||||||||||||||||||||||
analysed issue | analysis result | ||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
name of alteration | no title | ||||||||||||||||||||||||||||||||||||||||||||||
alteration (phys. location) | chr3:52740182C>GN/A show variant in all transcripts IGV | ||||||||||||||||||||||||||||||||||||||||||||||
HGNC symbol | SPCS1 | ||||||||||||||||||||||||||||||||||||||||||||||
Ensembl transcript ID | ENST00000423431 | ||||||||||||||||||||||||||||||||||||||||||||||
Genbank transcript ID | N/A | ||||||||||||||||||||||||||||||||||||||||||||||
UniProt peptide | Q9Y6A9 | ||||||||||||||||||||||||||||||||||||||||||||||
alteration type | single base exchange | ||||||||||||||||||||||||||||||||||||||||||||||
alteration region | intron | ||||||||||||||||||||||||||||||||||||||||||||||
DNA changes | g.1212C>G | ||||||||||||||||||||||||||||||||||||||||||||||
AA changes | N/A | ||||||||||||||||||||||||||||||||||||||||||||||
position(s) of altered AA if AA alteration in CDS | N/A | ||||||||||||||||||||||||||||||||||||||||||||||
frameshift | N/A | ||||||||||||||||||||||||||||||||||||||||||||||
known variant | Reference ID: rs6617
| ||||||||||||||||||||||||||||||||||||||||||||||
regulatory features | Cmyc, Transcription Factor, Cmyc TF binding DNase1, Open Chromatin, DNase1 Hypersensitive Site E2F1, Transcription Factor, E2F1 Transcription Factor Binding E2F6, Transcription Factor, E2F6 Transcription Factor Binding ELF1, Transcription Factor, ELF1 Transcription Factor Binding ETS1, Transcription Factor, ETS1 Transcription Factor Binding Gabp, Transcription Factor, Gabp TF binding H2AZ, Histone, Histone 2A variant Z H2BK120ac, Histone, Histone 2B Lysine 120 Acetylation H2BK5ac, Histone, Histone 2B Lysine 5 Acetylation H3K18ac, Histone, Histone 3 Lysine 18 Acetylation H3K27ac, Histone, Histone 3 Lysine 27 Acetylation H3K27me3, Histone, Histone 3 Lysine 27 Tri-Methylation H3K4ac, Histone, Histone 3 Lysine 4 Acetylation H3K4me2, Histone, Histone 3 Lysine 4 Di-Methylation H3K4me3, Histone, Histone 3 Lysine 4 Tri-Methylation H3K79me2, Histone, Histone 3 Lysine 79 di-methylation H3K9ac, Histone, Histone 3 Lysine 9 Acetylation H4K5ac, Histone, Histone 4 Lysine 5 Acetylation H4K8ac, Histone, Histone 4 Lysine 8 Acetylation H4K91ac, Histone, Histone 4 Lysine 91 Acetylation HDAC1, Transcription Factor, HDAC1 Transcription Factor Binding HEY1, Transcription Factor, HEY1 Transcription Factor Binding Max, Transcription Factor, Max TF binding PolII, Polymerase, RNA Polymerase II Promoter Associated, Regulatory Feature, Promoter like regulatory feature SIX5, Transcription Factor, SIX5 Transcription Factor Binding Sin3Ak20, Transcription Factor, Sin3Ak20 Transcription Factor Binding TAF1, Transcription Factor, TAF1 Transcription Factor Binding THAP1, Transcription Factor, THAP1 Transcription Factor Binding Tcf12, Transcription Factor, Tcf12 Transcription Factor Binding Tr4, Transcription Factor, Tr4 Transcription Factor Binding Yy1, Transcription Factor, Yy1 Transcription Factor Binding | ||||||||||||||||||||||||||||||||||||||||||||||
phyloP / phastCons |
| ||||||||||||||||||||||||||||||||||||||||||||||
splice sites | splice site change before start ATG (at aa -9) |
| ||||||||||||||||||||||||||||||||||||||||||||||
distance from splice site | 478 | ||||||||||||||||||||||||||||||||||||||||||||||
Kozak consensus sequence altered? | N/A | ||||||||||||||||||||||||||||||||||||||||||||||
conservation protein level for non-synonymous changes | N/A | ||||||||||||||||||||||||||||||||||||||||||||||
protein features |
| ||||||||||||||||||||||||||||||||||||||||||||||
length of protein | N/A | ||||||||||||||||||||||||||||||||||||||||||||||
AA sequence altered | N/A | ||||||||||||||||||||||||||||||||||||||||||||||
position of stopcodon in wt / mu CDS | N/A | ||||||||||||||||||||||||||||||||||||||||||||||
position (AA) of stopcodon in wt / mu AA sequence | N/A | ||||||||||||||||||||||||||||||||||||||||||||||
position of stopcodon in wt / mu cDNA | N/A | ||||||||||||||||||||||||||||||||||||||||||||||
poly(A) signal | N/A | ||||||||||||||||||||||||||||||||||||||||||||||
conservation nucleotide level for all changes - no scoring up to now | N/A | ||||||||||||||||||||||||||||||||||||||||||||||
position of start ATG in wt / mu cDNA | 235 / 235 | ||||||||||||||||||||||||||||||||||||||||||||||
chromosome | 3 | ||||||||||||||||||||||||||||||||||||||||||||||
strand | 1 | ||||||||||||||||||||||||||||||||||||||||||||||
last intron/exon boundary | 352 | ||||||||||||||||||||||||||||||||||||||||||||||
theoretical NMD boundary in CDS | 67 | ||||||||||||||||||||||||||||||||||||||||||||||
length of CDS | 243 | ||||||||||||||||||||||||||||||||||||||||||||||
coding sequence (CDS) position | N/A | ||||||||||||||||||||||||||||||||||||||||||||||
cDNA position (for ins/del: last normal base / first normal base) | N/A | ||||||||||||||||||||||||||||||||||||||||||||||
gDNA position (for ins/del: last normal base / first normal base) | 1212 | ||||||||||||||||||||||||||||||||||||||||||||||
chromosomal position (for ins/del: last normal base / first normal base) | 52740182 | ||||||||||||||||||||||||||||||||||||||||||||||
original gDNA sequence snippet | ACGCGCAGTGCCAGACCTTACCCCTCACGGTCCTTAAGTCT | ||||||||||||||||||||||||||||||||||||||||||||||
altered gDNA sequence snippet | ACGCGCAGTGCCAGACCTTAGCCCTCACGGTCCTTAAGTCT | ||||||||||||||||||||||||||||||||||||||||||||||
original cDNA sequence snippet | N/A | ||||||||||||||||||||||||||||||||||||||||||||||
altered cDNA sequence snippet | N/A | ||||||||||||||||||||||||||||||||||||||||||||||
wildtype AA sequence | MFQGIILFSA IVGFIYGYVA EQFGWTVYIV MAGFAFSCLL TLPPWPIYRR HPLKWLPVQE SSTDDKKPGE RKIKRHAKNN * | ||||||||||||||||||||||||||||||||||||||||||||||
mutated AA sequence | N/A | ||||||||||||||||||||||||||||||||||||||||||||||
speed | 0.94 s | ||||||||||||||||||||||||||||||||||||||||||||||