mutation t@sting

documentation

Prediction

disease causing

Model: without_aae, prob: 1 (classification due to ClinVar, real probability is shown anyway) (explain)

Summary

known disease mutation at this position (HGMD CM990225)
known disease mutation: rs17789 (pathogenic)
protein features (might be) affected
splice site changes

hyperlink

analysed issue

analysis result

name of alteration

no title

alteration (phys. location)

chr12:110719662G>AN/A show variant in all transcripts IGV

HGNC symbol

ATP2A2

Ensembl transcript ID

ENST00000552636

Genbank transcript ID

N/A

UniProt peptide

P16615

alteration type

single base exchange

alteration region

intron

DNA changes

g.1102G>A

AA changes

N/A

position(s) of altered AA
if AA alteration in CDS

N/A

frameshift

N/A

known variant

Reference ID: rs28929478
Allele 'A' was neither found in ExAC nor 1000G.
known disease mutation: rs17789 (pathogenic for Keratosis follicularis|not provided) dbSNP NCBI variation viewer
known disease mutation at this position, please check HGMD for details (HGMD ID CM990225)

known disease mutation at this position, please check HGMD for details (HGMD ID CM990225)
known disease mutation at this position, please check HGMD for details (HGMD ID CM990225)

regulatory features

Cmyc, Transcription Factor, Cmyc TF binding
DNase1, Open Chromatin, DNase1 Hypersensitive Site
E2F1, Transcription Factor, E2F1 Transcription Factor Binding
E2F6, Transcription Factor, E2F6 Transcription Factor Binding
Gene Associated, Regulatory Feature, Gene associated regulatory feature
H2BK5ac, Histone, Histone 2B Lysine 5 Acetylation
H3K27ac, Histone, Histone 3 Lysine 27 Acetylation
H3K36me3, Histone, Histone 3 Lysine 36 Tri-Methylation
H3K4me2, Histone, Histone 3 Lysine 4 Di-Methylation
H3K4me3, Histone, Histone 3 Lysine 4 Tri-Methylation
H3K79me2, Histone, Histone 3 Lysine 79 di-methylation
H3K9ac, Histone, Histone 3 Lysine 9 Acetylation
H4K5ac, Histone, Histone 4 Lysine 5 Acetylation
H4K91ac, Histone, Histone 4 Lysine 91 Acetylation
Max, Transcription Factor, Max TF binding
PolII, Polymerase, RNA Polymerase II
Promoter Associated, Regulatory Feature, Promoter like regulatory feature
Sin3Ak20, Transcription Factor, Sin3Ak20 Transcription Factor Binding
TAF1, Transcription Factor, TAF1 Transcription Factor Binding
Yy1, Transcription Factor, Yy1 Transcription Factor Binding

phyloP / phastCons

	PhyloP	PhastCons
(flanking)	4.224	1
	3.278	1
(flanking)	0.832	1

explain score(s) and/or inspect your position(s) in in UCSC Genome Browser

splice sites

splice site change before start ATG (at aa -60) |

effect	gDNA position	score	detection sequence	exon-intron border
Donor increased	1107	wt: 0.22 / mu: 0.40	wt: GGCTGAGCCTGGAAC mu: AGCTGAGCCTGGAAC	CTGA\|gcct
Donor increased	1102	wt: 0.86 / mu: 0.98	wt: TACGGGGCTGAGCCT mu: TACGGAGCTGAGCCT	CGGG\|gctg

distance from splice site

747

Kozak consensus sequence altered?

N/A

conservation
protein level for non-synonymous changes

N/A

protein features

start (aa)	end (aa)	feature	details
1	48	TOPO_DOM	Cytoplasmic (By similarity).	might get lost (downstream of altered splice site)
49	69	TRANSMEM	Helical; Name=1; (By similarity).	might get lost (downstream of altered splice site)
70	89	TOPO_DOM	Lumenal (By similarity).	might get lost (downstream of altered splice site)
90	110	TRANSMEM	Helical; Name=2; (By similarity).	might get lost (downstream of altered splice site)
111	253	TOPO_DOM	Cytoplasmic (By similarity).	might get lost (downstream of altered splice site)
143	143	CROSSLNK	Glycyl lysine isopeptide (Lys-Gly) (interchain with G-Cter in ubiquitin) (By similarity).	might get lost (downstream of altered splice site)
254	273	TRANSMEM	Helical; Name=3; (By similarity).	might get lost (downstream of altered splice site)
274	295	TOPO_DOM	Lumenal (By similarity).	might get lost (downstream of altered splice site)
294	294	MOD_RES	Nitrated tyrosine.	might get lost (downstream of altered splice site)
295	295	MOD_RES	Nitrated tyrosine.	might get lost (downstream of altered splice site)
296	313	TRANSMEM	Helical; Name=4; (By similarity).	might get lost (downstream of altered splice site)
304	304	METAL	Calcium 2; via carbonyl oxygen (By similarity).	might get lost (downstream of altered splice site)
305	305	METAL	Calcium 2; via carbonyl oxygen (By similarity).	might get lost (downstream of altered splice site)
307	307	METAL	Calcium 2; via carbonyl oxygen (By similarity).	might get lost (downstream of altered splice site)
309	309	METAL	Calcium 2 (By similarity).	might get lost (downstream of altered splice site)
314	756	TOPO_DOM	Cytoplasmic (By similarity).	might get lost (downstream of altered splice site)
351	351	ACT_SITE	4-aspartylphosphate intermediate (By similarity).	might get lost (downstream of altered splice site)
370	400	REGION	Interacts with phospholamban 1 (By similarity).	might get lost (downstream of altered splice site)
464	464	MOD_RES	N6-acetyllysine.	might get lost (downstream of altered splice site)
537	537	MOD_RES	Phosphothreonine (By similarity).	might get lost (downstream of altered splice site)
575	594	REGION	Interacts with HAX1.	might get lost (downstream of altered splice site)
663	663	MOD_RES	Phosphoserine.	might get lost (downstream of altered splice site)
702	702	METAL	Magnesium (By similarity).	might get lost (downstream of altered splice site)
706	706	METAL	Magnesium (By similarity).	might get lost (downstream of altered splice site)
757	776	TRANSMEM	Helical; Name=5; (By similarity).	might get lost (downstream of altered splice site)
767	767	METAL	Calcium 1 (By similarity).	might get lost (downstream of altered splice site)
770	770	METAL	Calcium 1 (By similarity).	might get lost (downstream of altered splice site)
777	786	TOPO_DOM	Lumenal (By similarity).	might get lost (downstream of altered splice site)
787	807	REGION	Interacts with phospholamban 2 (By similarity).	might get lost (downstream of altered splice site)
787	807	TRANSMEM	Helical; Name=6; (By similarity).	might get lost (downstream of altered splice site)
795	795	METAL	Calcium 2 (By similarity).	might get lost (downstream of altered splice site)
798	798	METAL	Calcium 1 (By similarity).	might get lost (downstream of altered splice site)
799	799	METAL	Calcium 2 (By similarity).	might get lost (downstream of altered splice site)
799	799	METAL	Calcium 1 (By similarity).	might get lost (downstream of altered splice site)
808	827	TOPO_DOM	Cytoplasmic (By similarity).	might get lost (downstream of altered splice site)
828	850	TRANSMEM	Helical; Name=7; (By similarity).	might get lost (downstream of altered splice site)
851	896	TOPO_DOM	Lumenal (By similarity).	might get lost (downstream of altered splice site)
897	916	TRANSMEM	Helical; Name=8; (By similarity).	might get lost (downstream of altered splice site)
907	907	METAL	Calcium 1 (By similarity).	might get lost (downstream of altered splice site)
917	929	TOPO_DOM	Cytoplasmic (By similarity).	might get lost (downstream of altered splice site)
930	948	TRANSMEM	Helical; Name=9; (By similarity).	might get lost (downstream of altered splice site)
949	963	TOPO_DOM	Lumenal (By similarity).	might get lost (downstream of altered splice site)
964	984	TRANSMEM	Helical; Name=10; (By similarity).	might get lost (downstream of altered splice site)
985	1042	TOPO_DOM	Cytoplasmic (By similarity).	might get lost (downstream of altered splice site)

length of protein

N/A

AA sequence altered

N/A

position of stopcodon in wt / mu CDS

N/A

position (AA) of stopcodon in wt / mu AA sequence

N/A

position of stopcodon in wt / mu cDNA

N/A

poly(A) signal

N/A

conservation
nucleotide level for all changes - no scoring up to now

N/A

position of start ATG in wt / mu cDNA

393 / 393

chromosome

strand

last intron/exon boundary

416

theoretical NMD boundary in CDS

cannot be calculated, too little distance between start ATG and last intron/exon boundary

length of CDS

135

coding sequence (CDS) position

N/A

cDNA position
(for ins/del: last normal base / first normal base)

N/A

gDNA position
(for ins/del: last normal base / first normal base)

1102

chromosomal position
(for ins/del: last normal base / first normal base)

110719662

original gDNA sequence snippet

CGGCGTCAACGAGAGTACGGGGCTGAGCCTGGAACAGGTCA

altered gDNA sequence snippet

CGGCGTCAACGAGAGTACGGAGCTGAGCCTGGAACAGGTCA

original cDNA sequence snippet

N/A

altered cDNA sequence snippet

N/A

wildtype AA sequence

MQLWVYGRKE MLKMPSKPLR NMSLKWAKCI DRTERVCSGL KLKT*

mutated AA sequence

N/A

speed

0.87 s

All positions are in basepairs (bp) if not explicitly stated differently.
AA/aa: amino acid; CDS: coding sequence; mu: mutated; NMD: nonsense-mediated mRNA decay; nt: nucleotide; wt: wildtype; TGP: 1000 Genomes Project