Prediction |
polymorphism |
Model: without_aae, prob: 0.999998712993056 (classification due to TGP/ExAC,
real probability is shown anyway)
(explain) |
Summary |
- homozygous in TGP or ExAC
- protein features (might be) affected
- splice site changes
|
hyperlink |
analysed issue |
analysis result |
name of alteration | no title |
alteration (phys. location) | chr17:48610272G>CN/A
show variant in all transcripts IGV
|
HGNC symbol | EPN3 |
Ensembl transcript ID | ENST00000541226 |
Genbank transcript ID | N/A |
UniProt peptide | Q9H201 |
alteration type | single base exchange |
alteration region | intron |
DNA changes | g.369G>C |
AA changes | N/A |
position(s) of altered AA if AA alteration in CDS | N/A |
frameshift | N/A |
known variant | Reference ID: rs755046
database | homozygous (C/C) | heterozygous | allele carriers |
1000G | 1643 | 742 | 2385 |
ExAC | 3142 | 1902 | 5044 |
|
regulatory features | CTCF, Transcription Factor, CCCTC-binding factor DNase1, Open Chromatin, DNase1 Hypersensitive Site H3K27me3, Histone, Histone 3 Lysine 27 Tri-Methylation H3K36me3, Histone, Histone 3 Lysine 36 Tri-Methylation H3K4me1, Histone, Histone 3 Lysine 4 Mono-Methylation H3K4me2, Histone, Histone 3 Lysine 4 Di-Methylation H3K4me3, Histone, Histone 3 Lysine 4 Tri-Methylation H3K9ac, Histone, Histone 3 Lysine 9 Acetylation Promoter Associated, Regulatory Feature, Promoter like regulatory feature |
phyloP / phastCons | | PhyloP | PhastCons |
(flanking) | 0.396 | 0.003 | | -0.089 | 0 | (flanking) | 0.01 | 0 | explain score(s) and/or inspect your position(s) in in UCSC Genome Browser |
splice sites | splice site change before start ATG (at aa -73) | effect | gDNA position | score | detection sequence | exon-intron border | Acc marginally increased | 370 | wt: 0.2597 / mu: 0.2776 (marginal change - not scored) | wt: CCCGAGGCTGTGCCGTCCCGCTGCTGCACAGGTCGGAGGGT mu: CCCGAGGCTGTGCCGTCCCCCTGCTGCACAGGTCGGAGGGT | ccgc|TGCT | Acc marginally increased | 380 | wt: 0.9016 / mu: 0.9573 (marginal change - not scored) | wt: TGCCGTCCCGCTGCTGCACAGGTCGGAGGGTCACCGCAGAG mu: TGCCGTCCCCCTGCTGCACAGGTCGGAGGGTCACCGCAGAG | acag|GTCG | Acc increased | 376 | wt: 0.46 / mu: 0.82 | wt: GCTGTGCCGTCCCGCTGCTGCACAGGTCGGAGGGTCACCGC mu: GCTGTGCCGTCCCCCTGCTGCACAGGTCGGAGGGTCACCGC | ctgc|ACAG | Acc increased | 378 | wt: 0.51 / mu: 0.80 | wt: TGTGCCGTCCCGCTGCTGCACAGGTCGGAGGGTCACCGCAG mu: TGTGCCGTCCCCCTGCTGCACAGGTCGGAGGGTCACCGCAG | gcac|AGGT | Acc increased | 375 | wt: 0.39 / mu: 0.78 | wt: GGCTGTGCCGTCCCGCTGCTGCACAGGTCGGAGGGTCACCG mu: GGCTGTGCCGTCCCCCTGCTGCACAGGTCGGAGGGTCACCG | gctg|CACA | Acc gained | 371 | 0.77 | mu: CCGAGGCTGTGCCGTCCCCCTGCTGCACAGGTCGGAGGGTC | ccct|GCTG | Donor gained | 374 | 0.36 | mu: CCTGCTGCACAGGTC | TGCT|gcac |
|
distance from splice site | 67 |
Kozak consensus sequence altered? | N/A |
conservation protein level for non-synonymous changes | N/A |
protein features | start (aa) | end (aa) | feature | details | | 8 | 8 | BINDING | Phosphatidylinositol lipid headgroup (By similarity). | might get lost (downstream of altered splice site) | 11 | 11 | BINDING | Phosphatidylinositol lipid headgroup (By similarity). | might get lost (downstream of altered splice site) | 12 | 144 | DOMAIN | ENTH. | might get lost (downstream of altered splice site) | 17 | 17 | MOD_RES | Phosphotyrosine. | might get lost (downstream of altered splice site) | 25 | 25 | BINDING | Phosphatidylinositol lipid headgroup (By similarity). | might get lost (downstream of altered splice site) | 30 | 30 | BINDING | Phosphatidylinositol lipid headgroup (By similarity). | might get lost (downstream of altered splice site) | 63 | 63 | BINDING | Phosphatidylinositol lipid headgroup (By similarity). | might get lost (downstream of altered splice site) | 73 | 73 | BINDING | Phosphatidylinositol lipid headgroup (By similarity). | might get lost (downstream of altered splice site) | 176 | 176 | MOD_RES | Phosphotyrosine. | might get lost (downstream of altered splice site) | 182 | 182 | MOD_RES | Phosphoserine (By similarity). | might get lost (downstream of altered splice site) | 186 | 186 | MOD_RES | Phosphotyrosine. | might get lost (downstream of altered splice site) | 209 | 228 | REPEAT | UIM 1. | might get lost (downstream of altered splice site) | 236 | 255 | REPEAT | UIM 2. | might get lost (downstream of altered splice site) | 321 | 323 | REPEAT | 1. | might get lost (downstream of altered splice site) | 321 | 406 | REGION | 5 X 3 AA repeats of [DE]-P-W. | might get lost (downstream of altered splice site) | 344 | 346 | REPEAT | 2. | might get lost (downstream of altered splice site) | 371 | 373 | REPEAT | 3. | might get lost (downstream of altered splice site) | 375 | 375 | CONFLICT | R -> K (in Ref. 2; BAF85666). | might get lost (downstream of altered splice site) | 387 | 389 | REPEAT | 4. | might get lost (downstream of altered splice site) | 393 | 393 | MOD_RES | Phosphoserine (By similarity). | might get lost (downstream of altered splice site) | 396 | 396 | CONFLICT | H -> Y (in Ref. 2; BAA91378). | might get lost (downstream of altered splice site) | 404 | 406 | REPEAT | 5. | might get lost (downstream of altered splice site) | 417 | 417 | CONFLICT | G -> S (in Ref. 2; BAF85666). | might get lost (downstream of altered splice site) | 524 | 526 | REPEAT | 1. | might get lost (downstream of altered splice site) | 524 | 631 | REGION | 3 X 3 AA repeats of N-P-F. | might get lost (downstream of altered splice site) | 537 | 539 | REPEAT | 2. | might get lost (downstream of altered splice site) | 629 | 631 | REPEAT | 3. | might get lost (downstream of altered splice site) |
|
length of protein | N/A |
AA sequence altered | N/A |
position of stopcodon in wt / mu CDS | N/A |
position (AA) of stopcodon in wt / mu AA sequence | N/A |
position of stopcodon in wt / mu cDNA | N/A |
poly(A) signal | N/A |
conservation nucleotide level for all changes - no scoring up to now | N/A |
position of start ATG in wt / mu cDNA | 330 / 330 |
chromosome | 17 |
strand | 1 |
last intron/exon boundary | 1578 |
theoretical NMD boundary in CDS | 1198 |
length of CDS | 753 |
coding sequence (CDS) position | N/A |
cDNA position (for ins/del: last normal base / first normal base) | N/A |
gDNA position (for ins/del: last normal base / first normal base) | 369 |
chromosomal position (for ins/del: last normal base / first normal base) | 48610272 |
original gDNA sequence snippet | TCCCGAGGCTGTGCCGTCCCGCTGCTGCACAGGTCGGAGGG |
altered gDNA sequence snippet | TCCCGAGGCTGTGCCGTCCCCCTGCTGCACAGGTCGGAGGG |
original cDNA sequence snippet | N/A |
altered cDNA sequence snippet | N/A |
wildtype AA sequence | MGMLWRRLND SGKNWRHVYK ALTLLDYLLK TGSERVAHQC RENLYTIQTL KDFQYIDRDG KDQGVNVREK VKQVMALLKD EERLRQERTH ALKTKERMAL EGIGIGSGQL GFSRRYGEDY SRSRGSPSSY NSSSSSPRYT SDLEQARPQT SGEEELQLQL ALAMSREEAE KEVRSWQGDG SPMANGAGAV VHHQRDREPE REERKEEEKL KTSQVLGRTQ RPVDPPGGLL QTPGLRSPQE PSCPEASPGI * |
mutated AA sequence | N/A |
speed | 0.12 s |
|
|